COVID-19’s Origin an Alternative Theory Summarized (U.S. Origin)


The United States Bioweapon Program

The U.S. Bioweapon program was officially born in Spring 1943 at Camp Detrick (Now known as Fort Detrick) in Maryland. the United States had signed but did not ratify the 1925 Geneva Protocol banning the use of biological as well as chemical weapons.  In 1975 the U.S. ratified both the 1925 Geneva Protocol and the 1972 Biological Weapons Convention (BWC)—international treaties outlawing biological warfare. Democrat president Franklin Roosevelt ordered the creation of the program under the War Research Service (WRS), which was also headquartered at Fort Detrick, shortly after the National Academy of Sciences created a classified report encouraging President Roosevelt to create a bioweapon program.

The War Research Service (WRS) was created as a civilian agency initially tasked to supervise the military Chemical Warfare Service’s (CWS) biological program. The agency was headed by George W. Merck, president of the Merck & Co. pharmaceutical firm which was founded in Germany prior to the first 2 world wars. The agency successfully developed offensive bioweapons such as Anthrax among others very quickly. The civilian agency was staffed by many U.S. academics like N. Paul Hudson of Ohio State University for example.

President Richard M. Nixon issued his “Statement on Chemical and Biological Defense Policies and Programs” on November 25, 1969 in a speech from Fort Detrick. The statement officially ended all U.S. offensive biological weapons programs. Nixon noted that biological weapons were “unreliable” despite the agency’s documented success and stated:

“The United States shall renounce the use of lethal biological agents and weapons, and all other methods of biological warfare. The United States will confine its biological research to defensive measures such as immunization and safety measures.”

Just years later many new RNA viruses like Hepatitis C would become prevalent across the world and mass vaccinations programs would become a new normal. Biologic research and creation did not slow down, it was just being done for “defense” rather than offense officially.

Ralph Baric

Ralph S. Baric is a professor and scientist at the University of North Carolina at Chapel Hill, where he has worked on gain-of-function research related to coronaviruses for decades. According to UNC “he has spent the past three decades as a world leader in the study of coronaviruses and is responsible for UNC-Chapel Hill’s world leadership in coronavirus research. For these past three decades, Dr. Baric has warned that the emerging coronaviruses represent a significant and ongoing global health threat, particularly because they can jump, without warning, from animals into the human population, and they tend to spread rapidly.”

There had only been 2 previous outbreaks of coronaviruses prior to the 2019 SARS-CoV outbreak. The first SARS-CoV outbreak happened in 2002 and led to about 700 total deaths. The second outbreak, which was MERS-CoV happened in 2012 and led to about 800 total deaths. Neither of these outbreaks represent “a significant and ongoing global health threat”. Baric had been wrong for 3 decades, until the COVID-19 outbreak in 2019. Many academics warned of the dangers of Baric’s efforts to make coronaviruses more infectious and deadly through gain of function research, but that did not stop Baric from doing just that.

In 2006, Baric published a paper titled Synthetic Viral Genomics: Risks and Benefits for Science and Society in which he primarily discusses the risks and benefits of bioweapons. Obviously, any moral person knows there is no benefit to biological warfare, Baric clearly believes there are benefits to biological weapons.

In that very same paper Baric goes on to describe a powerful technique that provides the bioterrorist with a “scapegoat” option; leaving a sequence signature that misdirects efforts at tracking the true originators of the crime.

Baric literally describes how the U.S. Government could create a synthetic virus that appears to be created from somewhere else and then use that to inflame worsening tensions and justify U.S. military retaliation.

In 2021, Baric was elected member of the U.S. National Academy of Sciences (The same one that originally encouraged the development of a U.S. bioweapon program).

What is COVID-19?

Before going any further it will be important to understand a few facts about COVID-19 and what makes it so much more infectious and deadly than previous coronaviruses. COVID-19 has an insertion of a furin cleavage site (FCS) in its spike protein. This Furin Cleavage site has NEVER been recorded in any previous coronavirus. Many studies demonstrate a critical role for the furin cleavage site insertion in COVID-19 replication and pathogenesis. Without the Furin Cleavage Site, the coronavirus would have remained a non-issue. The insertion of a Furin Cleavage Site allows the coronavirus to bind to the Human ACE2 receptor and replicate (remember this it is very important).

The genome sequence that you can see for the amino acid sequence of the Furin Cleavage Site is: CAGACTAATTCTCCTCGGCGGGCACGTAGT which is 30 nucleotides coding for 10 amino acids. The chances of this sequence to naturally arise are extremely small (you are over 60,000 times more likely to be stuck by lightning). That is without accounting for the 3 gp120 HIV inserts also found in COVID-19 but not found in any other coronavirus. So that leaves synthetic (lab) insertion or recombination from another virus naturally, the problem is this sequence has NEVER been found in any known virus so that can’t be it either.

Surprisingly, this exact sequence can be found in the US patent 9,587,003 filed on Feb. 4, 2016, which is a patent from none other than the Pharmaceutical company Moderna (who created 1 of the currently 2 FDA approved COVID-19 vaccines for the U.S. Government and made millions of dollars).

For 2 years despite this clear evidence of COVID-19 being lab created academics, the U.S. Government, the media, the pharmaceutical industry, and others have denied the so called “lab leak theory” and staunchly claimed COVID-19 mutated in Chinese bats (remember the scapegoat).

Now in 2023 academics, the U.S. Government, the media, the pharmaceutical industry, and others have flipped and decided a “lab leak” is the most likely origin of COVID-19 while pointing the finger at China’s Wuhan institute of Virology labs.

China-U.S. Workshop on the Challenges of Emerging Infections, Laboratory Safety and Global Health Security

The primary purpose of this section is to demonstrate how closely the U.S. group and Chinese group of scientists were. The photo below is from China January 2019, this was the last time the workshop was held before the COVID-19 pandemic began.

According to the National Academies of Sciences: Since 2015, the National Academies of Sciences has organized a series of meetings on the challenges of emerging infections, laboratory safety, and global health security with the Chinese Academy of Sciences (CAS), Chinese Center for Disease Control and Prevention (CCDC), and other Chinese life science and public health organizations.  Academy members and other top-flight American researchers in human and animal virology and immunology participated, including current and former directors of BSL-4 laboratories, former CDC, and former uniform military biodefense experts. They have met with China’s BSL-4 laboratory directors and researchers from top universities and research centers across China. The topics discussed included basic and applied research on infectious diseases; the challenges of combating emerging infections; life-science collaboration and research-data sharing; high-containment biological laboratory management, safety and security; and responsible conduct in the use of gene editing in infectious disease research.

The meetings enabled scientists from the United States and China to discuss research findings on diseases of mutual concern to China and the United States, to share best practices and lessons learned for managing and operating high containment biological laboratories, and to establish new collaborative research and institutional partnerships. These meetings would also allow the U.S. group to gather valuable information that could later be used to turn China into Ralph Baric’s “scapegoat”. At this workshop the U.S. group could easily receive sequences of the Wuhan Institute of Virology’s latest strains of coronaviruses, which could then be taken and used to create COVID-19 for approximately $6,000 according to Ralph Baric. (More on this later) Below is a summary of what Baric said at this very workshop:

The low cost of synthesizing viruses will be very relevant to the later mentioned DARPA DEFUSE proposal. Below is a list of all participants of the workshop and their current affiliations at the time:

The DEFUSE Proposal

In 2018 The EcoHealth Alliance in collaboration with Ralph Baric’s Lab at UNC submitted a proposal to DARPA to receive funding for “Project DEFUSE: Defusing the threat of bat-borne coronaviruses”.

The proposal details the group’s plan to synthesize novel coronaviruses. They would evaluate how coronaviruses could use the human ACE2 (like COVID-19 does) to grow in human cells. They would also insert human specific furin cleavage sites to evaluate growth potential in monkey and Human airway epithelial cells, which is suspiciously the exact same way COVID-19 would infect humans less than 2 years later

The document lists Ralph Baric’s labs tasks as assessing pathogenesis in the Human ACE2, synthetically modifying the spike protein with cleavage sites and glycosylation sites, and even testing effects of high-consequence micro-variants on human crossover potential. Which is exactly what this same group of researchers told us happened naturally less than 2 years later.

DARPA refused the proposal with 2 out of 3 reviewers saying the proposal was “selectable but not recommended” because of the risks of Gain of Function research. This does not mean this research was not done by the group, it just means DARPA didn’t fund it at that time. It doesn’t even mean that DARPA didn’t later fund it. Remember Baric said himself a novel coronavirus could be synthesized for $6,000 which is nothing for these organizations. Baric even admits he is close with DARPA in his own emails:

How many coincidences are too many?

We are expected to believe that Ralph Baric and EcoHealth Alliance proposed ways to frame other countries for bioweapon creation, requested funding to insert Furin Cleavage Sites, and glycoprotein’s into coronavirus and when exactly that happened just months later it was either natural or the Wuhan institute of Virology doing what Ralph Baric was planning on doing? The evidence clearly points to COVID-19 being created in America, and it even points to COVID-19 spreading in America before China.

EVALI

In the summer of 2019, a mysterious respiratory disease was detected spreading across the United States. It was originally blamed on E-cigarette, or vaping, product use-associated lung injury or EVALI. Oddly enough EVALI symptoms essentially perfectly mirrored COVID-19 symptoms with the exception of the loss of taste which the virus could have easily mutated to cause by 2020 when COVID-19 was officially detected in the United States. EVALI is no longer a thing, so we are also expected to believe vaping was only getting people sick right up until COVID-19 was officially detected in the U.S. then all the sudden vapes magically decided to stop making people sick… The CDC’s own data shows EVALI spreading across the states months before anyone got sick in China, and as soon as COVID-19 officially reaches the United States, no more EVALI.

How did COVID-19 get to Wuhan?

If COVID-19 was created in a U.S. lab and not at the Wuhan Institute of Virology how did it get to Wuhan in late 2019? Well that’s actually very simple, the U.S. military took it to Wuhan when they visited for the World Military Games held from October 18–27, 2019 hosted in Wuhan, China. 59 U.S. Military members actually played in the games, but many more U.S. government employees were in Wuhan along with them. Multiple studies have even found the 2019 Military games to be the very first COVID-19 super spreader event in the world.

Why did the Wuhan Institute of Virology take their database offline?

It could be because China quickly realized what was happening to them, the U.S. government and researchers would have already known that database could be used to frame China. More likely it’s because A memorandum of understanding between the Wuhan lab and the Galveston National Laboratory at the University of Texas Medical Branch states that each lab can ask the other to return or “destroy” any so-called “secret files” — any communications, documents, data or equipment resulting from their collaboration — and ask that they wipe any copies.

“The party is entitled to ask the other to destroy and/or return the secret files, materials and equipment without any backups,” it states.

This right is retained even after the agreement’s five-year term ends in October 2022. All documents are eligible for destruction under the agreement’s broad language.

“All cooperation … shall be treated as confidential information by the parties,” the agreement states.

Why would the U.S. government do this?

It’s no secret that tensions between China and the United States have been rising especially since America began funding Ukraine in its war against Russia. Like Ralph Baric said in 2006, a scenario exactly like the one described in this paper could be used by the United States to escalate tensions further and justify military intervention which is clearly what the U.S. government has been considering for a long time. Not only that, the COVID-19 pandemic expanded the wealth gap even more in the United States. The rich elite and big industries like the pharmaceutical industry in the United States made massive profits as a result of the Pandemic, and coincidently they are also some of the biggest donors and lobbyist for the U.S. government.

Recommendation

Thus far the U.S. Government and congress has essentially ignored the possibility that COVID-19 was created and released right here in the United States. The COVID committee should immediately question the American participants listed above as well as employees of other U.S. NGOs like EcoHealth Alliance under oath. Finding the true origin is extremely important to ensure lab made viruses are not released for any reason in the future and it could help those injured by COVID-19 and the COVID vaccines recover. Millions are dead, millions were hurt by the pandemic and the mandates, and the U.S. citizens deserve answers, not a war with China.


Note: I purposefully did not link sources for many of the claims made, this was done deliberately to encourage readers to read more into each of these subjects since this could easily be a book and there is so much information on each of these subjects available online. The point of this press release is to summarize the basic outline of how COVID-19 could have originated in the United States.

PDF Version Available Below:

Make sure to check out the previous publication on this subject:


Leave a comment